A 2020 update on the use of genetic testing for patients

Ivan September 9, 2020 0 Comments
myasthenickids

A 2020 update on the use of genetic testing for patients with primary immunodeficiency

  • Introduction: Genetic testing of patients with clinically diagnosed or suspected primary immunodeficiencies (PIDs) constitutes standard of care. Choice of testing modality and patient attributes can impact the likelihood of securing a diagnosis.
  • Areas covered: Published diagnostic rates for gene panel testing, exome sequencing (WES), and whole genome sequencing are compared among cohorts identified within PubMed. Performance of the testing platforms is reviewed in PIDs taken as a whole, followed by separate cohorts of patients with suspected PIDs, specific PIDs, and clinical phenotypes that can be associated with underlying PIDs.
  • Expert opinion: Massively parallel high throughput sequencing clearly represents the most expedient method for diagnosis of PIDs. For patients from highly consanguineous backgrounds, WES and whole genome sequencing should be performed to obtain optimal diagnostic yield. For patients for whom familial consanguinity is unlikely, choice of platform depends upon the phenotype. In patients with suspected PIDs, assessment for copy number variants is important, whether as part of gene panel bioinformatic analyses or combined with WES.
  • Diagnostic rates overall for massively parallel sequencing are high for clinically diagnosed and suspected PIDs. WES may have a slightly higher overall yield, but gene panel testing represents a cost effective and efficient reasonable initial step.
myasthenickids
myasthenickids
Mouse CXCL1/KC ELISA Kit
RK00038 96 Tests
EUR 521
GRO / KC (CXCL1) Protein
20-abx260684
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
GRO / KC (CXCL1) Protein
20-abx261870
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
GRO1/KC Mouse Recombinant Protein (CXCL1)
PROTP12850-1 Regular: 20ug
EUR 317
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.
Recombinant Mouse (E.Coli) GRO/KC (CXCL1)
RP-1037 5 ug
EUR 164
GRO/KC (CXCL1), Rat Recombinant
P1288-25
EUR 370
GRO/KC (CXCL1), Rat Recombinant
P1288-5
EUR 175
Recombinant Murine KC (CXCL1) Protein
PROTP12850-2 20ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.
GRO, KC, CXCL1, rRtGRO, rat
RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag
PROTP12850 Regular: 20ug
EUR 317
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)
RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Recombinant Rat GRO/KC (CXCL1) Protein
PROTP14095-1 25ug
EUR 317
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.
Rat CXCL1/CINC-1/KC ELISA Kit
RK00196 96 Tests
EUR 521
KC protein (Mouse)
30R-AK001 20 ug
EUR 273
Description: Purified recombinant Mouse KC protein
Anti-CXCL1 antibody
STJ72026 100 µg
EUR 260
Anti-CXCL1 antibody
STJ28366 100 µl
EUR 277
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Rabbit Anti Mouse Cxcl1 Polyclonal Antibody
CPBT-65100RM 0.1 mg
EUR 881
KC antibody
70R-KR006 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal KC antibody
KC Antibody
5211-100
EUR 376
KC Antibody
5212-100
EUR 392
KC Antibody
5212-30T
EUR 146
KC antibody
20R-1786 100 ug
EUR 651
Description: Rabbit polyclonal KC antibody
KC antibody
70R-12297 100 ug
EUR 527
Description: Rabbit polyclonal KC antibody
KC antibody
70R-12298 100 ug
EUR 492
Description: Rabbit polyclonal KC antibody
anti-7-ketocholesterol (7-KC) (35A)
LF-MA90006 20 ug
EUR 1025
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)
anti-7-ketocholesterol (7-KC) (35A)
LF-MA90007 100 ug
EUR 2725
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)
Anti-GRO alpha/Cxcl1 Antibody
A00533 100ug/vial
EUR 294
Anti-GRO alpha/CXCL1 Antibody
PA1760 100ug/vial
EUR 294
Polyclonal KC Antibody
APR16969G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:
KC 12291 hydrochloride
B7332-10 10 mg
EUR 373
KC 12291 hydrochloride
B7332-50 50 mg
EUR 1363
KC Blocking Peptide
33R-11041 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298
KC Blocking Peptide
5212BP-50
EUR 153
GRO-alpha/CXCL1, Mouse
HY-P7188 50ug
EUR 533
Mouse CXCL1 ELISA Kit
55R-1741 1 kit
EUR 624
Description: ELISA kit for detection of CXCL1 in the research laboratory
Mouse CXCL1 shRNA Plasmid
20-abx970673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
CXCL1 siRNA
20-abx901350
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXCL1/GRO
E21-597 10ug
EUR 343
CXCL1/GRO
EF012822 96 Tests
EUR 689
CXCL1 siRNA
20-abx913248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXCL1 siRNA
20-abx913249
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXCL1 Antibody
43679-100ul 100ul
EUR 252
CXCL1 protein
30R-3156 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein
CXCL1 Antibody
33054-100ul 100ul
EUR 252
CXCL1 antibody
70R-14297 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-10502 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-15473 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-16681 50 ul
EUR 435
Description: Rabbit polyclonal CXCL1 antibody
CXCL1 Antibody
1-CSB-PA006239GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CXCL1 Antibody
1-CSB-PA009036
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
Cxcl1 Antibody
1-CSB-PA09217A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
CXCL1 Antibody
1-CSB-PA06097A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
pEGFP- CXCL1
PVT10178 2 ug
EUR 301
Rabbit Anti Rat Cxcl1 Polyclonal Antibody
CPBT-65101RR 0.1 mg
EUR 881
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
KiloGreen 2X qPCR MasterMix-iCycler
MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140
GRO/KC, murine recombinant
4210-100
EUR 773
GRO/KC, murine recombinant
4210-1000
EUR 3856
GRO/KC, murine recombinant
4210-20
EUR 256
ELISA kit for Mouse CXCL1
EK5299 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse CXCL1 PicoKine ELISA Kit
EK0723 96 wells
EUR 456
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.
CXCL1 protein (Mouse) (His tag)
80R-3368 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)
CXCL1 protein (Mouse) (His tag)
80R-3439 50 ug
EUR 257
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)
Mouse CXCL1 Detection Assay Kit
6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit
Mouse CXCL1/GROα ELISA kit
LF-EK50473 1×96T
EUR 648
Cxcl1 ORF Vector (Mouse) (pORF)
ORF042286 1.0 ug DNA
EUR 95
CXCL1 ELISA Kit (Mouse) (OKAN04583)
OKAN04583 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL
CXCL1 ELISA Kit (Mouse) (OKBB00312)
OKBB00312 96 Tests
EUR 544
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml
CXCL1 ELISA Kit (Mouse) (OKCD05712)
OKCD05712 96 Wells
EUR 609
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL
KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)
OKAG00090 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL
CXCL1 Conjugated Antibody
C33054 100ul
EUR 397
CXCL1 cloning plasmid
CSB-CL006239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.
CXCL1 Blocking Peptide
20-abx061039
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Cxcl1 Polyclonal Antibody
A51950 100 µg
EUR 570.55
Description: fast delivery possible
CXCL1 Polyclonal Antibody
A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research
CXCL1 Blocking Peptide
33R-7741 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502
CXCL1 antibody (HRP)
60R-2236 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (HRP)
CXCL1 antibody (FITC)
60R-2237 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (FITC)
CXCL1 antibody (biotin)
60R-2238 100 ug
EUR 327
Description: Rabbit polyclonal CXCL1 antibody (biotin)
Recombinant Human CXCL1
P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1
pCMV-SPORT6-CXCL1
PVT13291 2 ug
EUR 391
GRO-alpha/CXCL1 (CHO-expressed), Mouse
HY-P7186 50ug
EUR 337
Mouse CXCL1 AssayLite Antibody (FITC Conjugate)
70027-05141 150 ug
EUR 428
Cxcl1 sgRNA CRISPR Lentivector set (Mouse)
K4368201 3 x 1.0 ug
EUR 339
Mouse Growth-regulated alpha protein (Cxcl1)
1-CSB-RP092174m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli
Mouse CXCL1/GROα ELISA kit (4X96T)
LF-EK50474 4×96T
EUR 2201
Rat CXCL1 shRNA Plasmid
20-abx986581
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CXCL1 ELISA Kit
ELA-E1210h 96 Tests
EUR 824
CXCL1 ELISA KIT|Human
EF003720 96 Tests
EUR 689
GRO-alpha/CXCL1, Human
HY-P7187 10ug
EUR 268

Breast cancer (BRCA) genetesting in ovarian cancer

The discovery of cancer-causing BRCA1/2 mutations and the emergence of genetic testing have brought precision in patient selection for poly-(ADP)-ribose polymerase inhibitor (PARPi) treatment. Interestingly, patients who are carriers of BRCA1/2 mutations have a higher risk for developing cancer, but respond better to DNA-damaging cytotoxic therapy, such as platinum-based chemotherapy.
The distinctive biology of ovarian cancer involves high genomic instability consisting of gene amplification, gene deletion, oncogene hypomethylation, loss of heterozygosity, and tumor suppressor gene promoter hypermethylation in many of the DNA damage response (DDR) genes, including BRCA1/2. Several of these genetic abnormalities can impair high fidelity DNA damage repair increasing the therapeutic audience for PARPi’s. This is especially important given the clinical development over the last decade of this group of agents and the dramatic increase in progression free survival among ovarian cancer patients who received PARPi, both in treatment or maintenance setting. In this review, we summarize our current understanding of the role of BRCA1/2 mutations in ovarian cancer and present relevant clinical trials in which BRCA1/2 was investigated as biomarker for therapy. We also outline the role of homologous recombination (HR) deficiency as biomarker by presenting the recent clinical development and recent approvals PARPi for firstline maintenance in ovarian cancer.

Haplotyping by linked-read sequencing (HLRS) of the genetic disease carriers for preimplantation genetictesting without a proband or relatives

Background: In order to mitigate the risk of allele dropout (ADO) and ensure the accuracy of preimplantation genetic testing for monogenic disease (PGT-M), it is necessary to construct parental haplotypes. Typically, haplotype resolution is obtained by genotyping multiple polymorphic markers in both parents and a proband or a relative. Sometimes, single sperm typing, or tests on the polar bodies may also be useful. Nevertheless, this process is time-consuming. At present, there was no simple linkage analysis strategy for patients without affected relatives.
Method: To solve this problem, we established a haplotyping by linked-read sequencing (HLRS) method without the requirement for additional relatives. First, the haplotype of the genetic disease carriers in the family was constructed by linked-read sequencing, and then the informative single nucleotide polymorphisms (SNPs) in upstream and downstream mutation region were selected to construct the embryo haplotype and to determine whether the embryo was carrying the mutation. Two families were selected to validate this method; one with alpha thalassemia and the other with NDP gene disorder.
Results: The haplotyping by linked-read sequencing (HLRS) method was successfully applied to construct parental haplotypes without recruiting additional family members; the method was also validated for PGT-M. The mutation carriers in these families were sequenced by linked-read sequencing, and their haplotypes were successfully phased. Adjacent SNPs of the mutation gene were identified.
The informative SNPs were chosen for linkage analyses to identify the carrier embryos. For the alpha thalassemia family, a normal blastocyst was transferred to the uterus and the accuracy of PGT-M was confirmed by amniocentesis at 16 weeks of gestation.
Conclusions: Our results suggest that HLRS can be applied for PGT-M of monogenic disorders or de novo mutations where the mutations haplotype cannot be determined due to absence of affected relatives.

Human Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Hu-48Tests 48 Tests
EUR 522

Human Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Hu-96Tests 96 Tests
EUR 724

Anti-CD163
DB-045-0.1 100 μl
EUR 212
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-0.2 200 μl
EUR 298
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-0.5 500 μl
EUR 384
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-1 1 ml
EUR 613
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated

Anti-CD163
DB-045-RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB-045-RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB045RTU-15 15 ml
EUR 354
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Anti-CD163
DB045RTU-7 7 ml
EUR 231
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Mouse Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Mu-48T 48T
EUR 508
  • Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Mu-96T 96T
EUR 661
  • Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Ra-48T 48T
EUR 508
  • Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit
DLR-CD163-Ra-96T 96T
EUR 661
  • Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Mu-48Tests 48 Tests
EUR 511

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Mu-96Tests 96 Tests
EUR 709

Rat Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Ra-48Tests 48 Tests
EUR 511

Rat Cluster Of Differentiation (CD163) ELISA Kit
RD-CD163-Ra-96Tests 96 Tests
EUR 709

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Mu-48Tests 48 Tests
EUR 534

Mouse Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Mu-96Tests 96 Tests
EUR 742

Rat Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Ra-48Tests 48 Tests
EUR 534

Rat Cluster Of Differentiation (CD163) ELISA Kit
RDR-CD163-Ra-96Tests 96 Tests
EUR 742

Anti-CD163 Antibody
A00812-1 100ug/vial
EUR 334

Anti-CD163 Antibody
PA1874 100ug/vial
EUR 294

Anti-CD163 Antibody
PA1874-1 100ug/vial
EUR 334

Anti-CD163 Antibody
STJ500423 100 µg
EUR 476

Anti-CD163 Antibody
STJ500424 100 µg
EUR 476

Anti-CD163 antibody
STJ110681 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-CD163 antibody
STJ160082 1 mL C
EUR 941

Anti-CD163 antibody
STJ16100302 100 µg
EUR 720

Anti-CD163 antibody
STJ16100324 1 mL
EUR 979

Anti-CD163 antibody
STJ180301 0.1 ml
EUR 215

Anti-CD163 antibody
STJ190009 200 µl
EUR 197
Description: Unconjugated Mouse monoclonal to CD163 (AS1A1)

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349

anti- CD163/M130 Antibody
FNab09771 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:300-1:1000
  • Immunogen: CD163
  • Uniprot ID: Q86VB7
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience, Stem Cells
Description: Antibody raised against CD163/M130 

Anti-CD163/M130 Antibody
A00812 100ul
EUR 397
Description: Rabbit IgG polyclonal antibody for Scavenger receptor cysteine-rich type 1 protein M130 (CD163) detection.tested for IF, IHC, WB in Human, Mouse, Rat. Various direct flourescent conjugates are available for FCM upon request. Please contact us for details.

Anti-Hu CD163 Purified
11-645-C025 0.025 mg
EUR 99

Anti-Hu CD163 Purified
11-645-C100 0.1 mg
EUR 158

Anti-Hu CD163 APC
1A-645-T025 25 tests
EUR 140

Anti-Hu CD163 APC
1A-645-T100 100 tests
EUR 240

Anti-Hu CD163 PE
1P-645-T025 25 tests
EUR 140

Anti-Hu CD163 PE
1P-645-T100 100 tests
EUR 240

Anti-CD163/M130 antibody
PAab09771 100 ug
EUR 355

Anti-CD163 Antibody BIOTIN
STJ500425 100 µg
EUR 586

Anti-CD163 Antibody FITC
STJ500426 100 µg
EUR 586

Anti-CD163 Antibody BIOTIN
STJ500427 100 µg
EUR 586

Anti-CD163 Antibody FITC
STJ500428 100 µg
EUR 586

Human CD163 antigen(CD163)ISA kit
GA-E0263HM-48T 48T
EUR 289

Human CD163 antigen(CD163)ISA kit
GA-E0263HM-96T 96T
EUR 466

human CD163 antigen,CD163 LISA kit
201-12-0247 96 tests
EUR 440
  • This CD163 antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human CD163 antigen(CD163)ISA kit
QY-E05066 96T
EUR 361

Mouse Anti Human Cd163 Monoclonal Antibody
CABT-47162MH 25 µg
EUR 372

Mouse Anti Human Cd163 Monoclonal Antibody
CABT-47163MH 0.2 mg
EUR 881

Anti-CD163 Rabbit Monoclonal Antibody
M00812 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD163 Antibody. Validated in IP, WB and tested in Human.

Anti-Hu CD163 PE-Cy7
T7-645-T025 25 tests
EUR 154

Anti-Hu CD163 PE-Cy7
T7-645-T100 100 tests
EUR 268

Anti-Hu CD163 PerCP-Cy5.5
T9-645-T025 25 tests
EUR 196

Anti-Hu CD163 PerCP-Cy5.5
T9-645-T100 100 tests
EUR 352

Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280

Porcine CD163 antigen,CD163 LISA kit
GA-E0045PC-48T 48T
EUR 364

Porcine CD163 antigen,CD163 LISA kit
GA-E0045PC-96T 96T
EUR 590

Canine CD163 antigen(CD163 LISA kit
GA-E0062CN-48T 48T
EUR 402

Canine CD163 antigen(CD163 LISA kit
GA-E0062CN-96T 96T
EUR 684

Mouse Anti Rat Cd163 Monoclonal Antibody
DMABT-47170MR 0.25 mg
EUR 741

Mouse Anti Rat Cd163 Monoclonal Antibody
DMABT-47171MR 0.1 mg
EUR 559

CD163 siRNA
20-abx910930
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD163 siRNA
20-abx910931
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD163 Antibody
20-abx242956
  • EUR 467.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 1-2 weeks.

CD163 Antibody
ABD8235 100 ug
EUR 438

CD163 Antibody
37157-100ul 100ul
EUR 252

CD163 Antibody
49553-100ul 100ul
EUR 333

CD163 Antibody
49553-50ul 50ul
EUR 239

CD163 antibody
10R-6496 100 ug
EUR 203
Description: Mouse monoclonal CD163 antibody

CD163 antibody
10R-CD163aRT 250 ug
EUR 716
Description: Mouse monoclonal CD163 antibody

CD163 Antibody
DF8235 200ul
EUR 304
Description: CD163 Antibody detects endogenous levels of total CD163.

CD163 Antibody
1-CSB-PA969205
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CD163 Antibody
1-CSB-PA801238LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Cd163 Antibody
1-CSB-PA650452LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Mouse Anti-Human CD163 monoclonal antibody, clone JID274
CABT-L2938-100uL500uL 100 uL, 500 uL
EUR 502

Anti-Human CD163 DyLight® 488 conjugated Antibody
A00812-Dyl488 100ug/vial
EUR 344

Anti-Human CD163 DyLight® 550 conjugated Antibody
A00812-Dyl550 100ug/vial
EUR 344

Human CD163 ELISA Kit
ELA-E1726h 96 Tests
EUR 824

Human CD163 shRNA Plasmid
20-abx956176
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD163 ELISA Kit
LF-EK50890 1×96T
EUR 648

Human CellExp? CD163, Human recombinant
9226-10
EUR 305

Human CellExp? CD163, Human recombinant
9226-50
EUR 773

Mouse Anti Pig Cd163 Monoclonal Antibody,FITC
CABT-47164MP 0.1 mg
EUR 881

Mouse Anti Pig Cd163 Monoclonal Antibody,RPE
CABT-47166MP 100 TEST
EUR 715

Mouse Anti Rat Cd163 Monoclonal Antibody,Biotin
DMABT-47168MR 0.1 mg
EUR 881

Mouse Anti Rat Cd163 Monoclonal Antibody,FITC
DMABT-47169MR 0.1 mg
EUR 881

Mouse Anti Rat Cd163 Monoclonal Antibody,RPE
DMABT-47172MR 100 TEST
EUR 892

Anti-CD163 Rabbit Monoclonal Antibody, Clone#RM371
M00812-1 100uL
EUR 385
Description: Anti-CD163 Rabbit Monoclonal Antibody, Clone#RM371 tested in WB, IHC, reactive to Human

CD163 Conjugated Antibody
C37157 100ul
EUR 397

CD163 Conjugated Antibody
C49553 100ul
EUR 397

Porcine CD163 Protein
20-abx260472
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

Cd163 Polyclonal Antibody
A53832 100 µg
EUR 570.55
Description: Ask the seller for details

CD163 Rabbit pAb
A8383-100ul 100 ul
EUR 308

CD163 Rabbit pAb
A8383-200ul 200 ul
EUR 459

CD163 Rabbit pAb
A8383-20ul 20 ul
EUR 183

CD163 Rabbit pAb
A8383-50ul 50 ul
EUR 223

CD163 antibody (PE)
61R-1319 100 tests
EUR 403
Description: Mouse monoclonal CD163 antibody (PE)

CD163 antibody (biotin)
61R-1569 100 ug
EUR 349
Description: Mouse monoclonal CD163 antibody (biotin)

CD163 antibody (biotin)
61R-CD163BHUBT 100 ug
EUR 921
Description: Mouse monoclonal CD163 antibody (biotin)

CD163 antibody (biotin)
61R-CD163CHUBT 250 ug
EUR 781
Description: Mouse monoclonal CD163 antibody (biotin)

Recombinant Porcine CD163
7-04750 10µg Ask for price

Recombinant Porcine CD163
7-04751 50µg Ask for price

Recombinant Porcine CD163
7-04752 1mg Ask for price

CD163 Blocking Peptide
DF8235-BP 1mg
EUR 195

ELISA kit for Human CD163
EK5296 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD163 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD163 PicoKine ELISA Kit
EK0715 96 wells
EUR 425
Description: For quantitative detection of human CD163 in cell culture supernates, serum and plasma(heparin).

QuickDetect? CD163 (Human) ELISA Kit
K4422-100
EUR 805

CD163 ORF Vector (Human) (pORF)
ORF017045 1.0 ug DNA
EUR 405

CD163 ELISA Kit (Human) (OKAN04666)
OKAN04666 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.273 ng/mL

CD163 ELISA Kit (Human) (OKCD07621)
OKCD07621 96 Wells
EUR 936
Description: Description of target: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.273ng/mL

CD163 ELISA Kit (Human) (OKBB00786)
OKBB00786 96 Wells
EUR 505
Description: Description of target: CD163(Cluster of Differentiation 163) is a human protein encoded by the CD163 gene. It has also been shown to mark cells of monocyte/macrophage lineage. CD163, a member of the scavenger receptor cysteine-rich(SRCR) superfamily, is exclusively expressed by monocytes and macrophages. Using FISH, somatic cell hybrid analysis, and radiation hybrid analysis, CD163 gene was mapped the to chromosome 12p13.3. CD163 is upregulated in a large range of diseases inflammatory diseases including type 2 diabetes, macrophage activation sickness, Tangier's disease, reumatoid arthritis etc.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <150pg/ml

CD163 ELISA Kit (Human) (OKBB01513)
OKBB01513 96 Wells
EUR 570
Description: Description of target: CD163(Cluster of Differentiation 163) is a human protein encoded by the CD163 gene. It has also been shown to mark cells of monocyte/macrophage lineage. CD163, a member of the scavenger receptor cysteine-rich(SRCR) superfamily, is exclusively expressed by monocytes and macrophages. Using FISH, somatic cell hybrid analysis, and radiation hybrid analysis, CD163 gene was mapped the to chromosome 12p13.3. CD163 is upregulated in a large range of diseases inflammatory diseases including type 2 diabetes, macrophage activation sickness, Tangier's disease, reumatoid arthritis etc.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <150pg/ml

CD163 sgRNA CRISPR Lentivector set (Human)
K0405601 3 x 1.0 ug
EUR 339

Human soluble CD163(sCD163) ELISA Kit
CSB-E14050h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human soluble CD163 (sCD163) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human soluble CD163(sCD163) ELISA Kit
1-CSB-E14050h
  • EUR 794.00
  • EUR 5028.00
  • EUR 2667.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human soluble CD163(sCD163) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

CD163(M130/1240) Antibody
BNC551240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF555 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC551240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF555 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC611240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF660R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC611240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF660R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC401240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF640R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC401240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF640R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC431240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF543 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC431240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF543 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC471240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF647 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC471240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF647 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC051240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF405M conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC051240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF405M conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC041240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF405S conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC041240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF405S conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNUB1240-100 100uL
EUR 209
Description: Primary antibody against CD163(M130/1240), Concentration: 0.2mg/mL

CD163(M130/1240) Antibody
BNUB1240-500 500uL
EUR 458
Description: Primary antibody against CD163(M130/1240), Concentration: 0.2mg/mL

CD163(M130/1240) Antibody
BNUM1240-50 50uL
EUR 395
Description: Primary antibody against CD163(M130/1240), 1mg/mL

Mouse CD163 shRNA Plasmid
20-abx979200
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD163(M130/1240) Antibody
BNC681240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF568 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC681240-500 500uL
EUR 544
Description: Primary antibody against CD163(M130/1240), CF568 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody
BNC701240-100 100uL
EUR 199
Description: Primary antibody against CD163(M130/1240), CF770 conjugate, Concentration: 0.1mg/mL

Leave a Reply

Your email address will not be published. Required fields are marked *