A 2020 update on the use of genetic testing for patients


A 2020 update on the use of genetic testing for patients with primary immunodeficiency

  • Introduction: Genetic testing of patients with clinically diagnosed or suspected primary immunodeficiencies (PIDs) constitutes standard of care. Choice of testing modality and patient attributes can impact the likelihood of securing a diagnosis.
  • Areas covered: Published diagnostic rates for gene panel testing, exome sequencing (WES), and whole genome sequencing are compared among cohorts identified within PubMed. Performance of the testing platforms is reviewed in PIDs taken as a whole, followed by separate cohorts of patients with suspected PIDs, specific PIDs, and clinical phenotypes that can be associated with underlying PIDs.
  • Expert opinion: Massively parallel high throughput sequencing clearly represents the most expedient method for diagnosis of PIDs. For patients from highly consanguineous backgrounds, WES and whole genome sequencing should be performed to obtain optimal diagnostic yield. For patients for whom familial consanguinity is unlikely, choice of platform depends upon the phenotype. In patients with suspected PIDs, assessment for copy number variants is important, whether as part of gene panel bioinformatic analyses or combined with WES.
  • Diagnostic rates overall for massively parallel sequencing are high for clinically diagnosed and suspected PIDs. WES may have a slightly higher overall yield, but gene panel testing represents a cost effective and efficient reasonable initial step.
RK00038 96 Tests
EUR 521.00
GRO / KC (CXCL1) Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
GRO / KC (CXCL1) Protein
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
GRO1/KC Mouse Recombinant Protein (CXCL1)
PROTP12850-1 Regular: 20ug
EUR 317.00
Description: KC Mouse Recombinant also known as N51 and GRO1 produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 77 amino acids and having a molecular mass of approximately 8 kDa.;The GRO-1 is purified by proprietary chromatographic techniques.
Recombinant Mouse (E.Coli) GRO/KC (CXCL1)
RP-1037 5 ug
EUR 164.00
GRO/KC (CXCL1), Rat Recombinant
EUR 370.00
GRO/KC (CXCL1), Rat Recombinant
EUR 175.00
Recombinant Murine KC (CXCL1) Protein
PROTP12850-2 20ug
EUR 317.00
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant murine KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.
GRO, KC, CXCL1, rRtGRO, rat
RC352-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
GRO1/KC Mouse, GRO/KC (CXCL1) Mouse Recombinant Protein, His Tag
PROTP12850 Regular: 20ug
EUR 317.00
Description: GRO1/KC Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 97 amino acids (25-96 a.a.) and having a molecular mass of 10.5kDa.;GRO1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
GRO-alpha, KC, CXCL1 (rMuKC), murine (mouse)
RC332-12 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Recombinant Rat GRO/KC (CXCL1) Protein
PROTP14095-1 25ug
EUR 317.00
Description: All three isoforms of GRO are CXC chemokines that can signal through the CXCR1 or CXCR2 receptors. The GRO proteins chemoattract and activate neutrophils and basophils. Recombinant rat GRO/KC is a 7.8 kDa protein consisting of 72 amino acids including the 'ELR' motif common to the CXC chemokine family that bind to CXCR1 or CXCR2.
RK00196 96 Tests
EUR 521.00
KC protein (Mouse)
30R-AK001 20 ug
EUR 273.00
Description: Purified recombinant Mouse KC protein
Anti-CXCL1 antibody
STJ28366 100 µl
EUR 277.00
Description: This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4.
Anti-CXCL1 antibody
STJ72026 100 µg
EUR 260.00
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349.00
Rabbit Anti Mouse Cxcl1 Polyclonal Antibody
CPBT-65100RM 0.1 mg
EUR 881.00
KC antibody
20R-1786 100 ug
EUR 651.00
Description: Rabbit polyclonal KC antibody
KC antibody
70R-12297 100 ug
EUR 527.00
Description: Rabbit polyclonal KC antibody
KC antibody
70R-12298 100 ug
EUR 492.00
Description: Rabbit polyclonal KC antibody
KC Antibody
EUR 376.00
KC Antibody
EUR 392.00
KC Antibody
EUR 146.00
KC antibody
70R-KR006 50 ug
EUR 273.00
Description: Affinity purified Rabbit polyclonal KC antibody
anti-7-ketocholesterol (7-KC) (35A)
LF-MA90006 20 ug
EUR 1025.00
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)
anti-7-ketocholesterol (7-KC) (35A)
LF-MA90007 100 ug
EUR 2725.00
Description: Mouse monoclonal to 7-ketocholesterol (7-KC)
Anti-GRO alpha/Cxcl1 Antibody
A00533 100ug/vial
EUR 294.00
Anti-GRO alpha/CXCL1 Antibody
PA1760 100ug/vial
EUR 294.00
KC Blocking Peptide
33R-11041 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KC antibody, catalog no. 70R-12298
KC Blocking Peptide
EUR 153.00
Polyclonal KC Antibody
APR16969G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KC . This antibody is tested and proven to work in the following applications:
KC 12291 hydrochloride
B7332-10 10 mg
EUR 373.00
KC 12291 hydrochloride
B7332-50 50 mg
EUR 1363.00
55R-1741 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory
Mouse CXCL1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
GRO-alpha/CXCL1, Mouse
HY-P7188 50ug
EUR 533.00
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse keinocyte chemoattractant (KC) ELISA kit
E03K0088-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse keinocyte chemoattractant (KC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
CXCL1 protein
30R-3156 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein
CXCL1 antibody
70R-16681 50 ul
EUR 435.00
Description: Rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-10502 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-14297 100 ug
EUR 327.00
Description: Affinity purified Rabbit polyclonal CXCL1 antibody
CXCL1 antibody
70R-15473 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody
CXCL1 Antibody
33054-100ul 100ul
EUR 252.00
CXCL1 Antibody
43679-100ul 100ul
EUR 252.00
CXCL1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CXCL1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
Cxcl1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cxcl1. Recognizes Cxcl1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
E21-597 10ug
EUR 343.00
EF012822 96 Tests
EUR 689.00
CXCL1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
PVT10178 2 ug
EUR 301.00
Rabbit Anti Rat Cxcl1 Polyclonal Antibody
CPBT-65101RR 0.1 mg
EUR 881.00
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280.00
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280.00
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280.00
KiloGreen 2X qPCR MasterMix-iCycler
MasterMix-KC 4 x 1.25 ml - 500 reactions (20 ul)
EUR 140.00
GRO/KC, murine recombinant
EUR 773.00
GRO/KC, murine recombinant
EUR 3856.00
GRO/KC, murine recombinant
EUR 256.00
Mouse CXCL1 Detection Assay Kit
6725 1 kit
EUR 483.55
Description: Mouse CXCL1 Detection Assay Kit
CXCL1 protein (Mouse) (His tag)
80R-3368 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)
CXCL1 protein (Mouse) (His tag)
80R-3439 50 ug
EUR 257.00
Description: Purified recombinant CXCL1 protein (Mouse) (His tag)
ELISA kit for Mouse CXCL1
EK5299 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CXCL1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse CXCL1 PicoKine ELISA Kit
EK0723 96 wells
EUR 456.00
Description: For quantitative detection of mouse CXCL1 in cell culture supernates and serum.
Mouse CXCL1/GROα ELISA kit
LF-EK50473 1×96T
EUR 648.00
Cxcl1 ORF Vector (Mouse) (pORF)
ORF042286 1.0 ug DNA
EUR 95.00
CXCL1 ELISA Kit (Mouse) (OKAN04583)
OKAN04583 96 Wells
EUR 792.00
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL
CXCL1 ELISA Kit (Mouse) (OKBB00312)
OKBB00312 96 Tests
EUR 544.00
Description: Description of target: Chemokine (C-X-C motif) ligand 1 (CXCL1) is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GROα, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-α). In humans, this protein is encoded by the CXCL1 gene. The gene for CXCL1 is located on human chromosome 4 amongst genes for other CXC chemokines. The mature form of CXCL1 is maximally 73 amino acids long. CXCL1 is secreted by human melanoma cells, has mitogenic properties and is implicated in melanoma pathogenesis. CXCL1 is expressed by macrophages, neutrophils and epithelial cells, and has neutrophil chemoattractant activity. This chemokine elicits its effects by signaling through the chemokine receptor CXCR2.CXCL1 decreased the severity of multiple sclerosis and may offer a neuro-protective function. The standard product used in this kit is recombinant mouse CXCL1, consisting of 77 amino acids with the molecular mass of 8KDa.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 1 pg/ml
CXCL1 ELISA Kit (Mouse) (OKCD05712)
OKCD05712 96 Wells
EUR 609.00
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL
KC ELISA Kit (Mouse) : 96 Wells (OKAG00090)
OKAG00090 96 Wells
EUR 596.00
Description: Description of target: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung.;Species reactivity: Mouse;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 8 pg/mL
CXCL1 Blocking Peptide
33R-7741 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXCL1 antibody, catalog no. 70R-10502
CXCL1 antibody (HRP)
60R-2236 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (HRP)
CXCL1 antibody (FITC)
60R-2237 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (FITC)
CXCL1 antibody (biotin)
60R-2238 100 ug
EUR 327.00
Description: Rabbit polyclonal CXCL1 antibody (biotin)
CXCL1 Blocking Peptide
  • EUR 286.00
  • EUR 425.00
  • 0
  • 1
  • Shipped within 5-10 working days.
CXCL1 Conjugated Antibody
C33054 100ul
EUR 397.00
CXCL1 cloning plasmid
CSB-CL006239HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaag
  • Show more
Description: A cloning plasmid for the CXCL1 gene.
Cxcl1 Polyclonal Antibody
A51950 100 µg
EUR 570.55
Description: fast delivery possible
CXCL1 Polyclonal Antibody
A51978 100 µg
EUR 570.55
Description: kits suitable for this type of research
Recombinant Human CXCL1
P0109 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09341
Description: Recombinant Human protein for CXCL1
PVT13291 2 ug
EUR 391.00
Mouse CXCL1 AssayLite Antibody (FITC Conjugate)
70027-05141 150 ug
EUR 428.00
Mouse Growth-regulated alpha protein (Cxcl1)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 11.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Growth-regulated alpha protein(Cxcl1),partial expressed in E.coli
GRO-alpha/CXCL1 (CHO-expressed), Mouse
HY-P7186 50ug
EUR 337.00
Cxcl1 sgRNA CRISPR Lentivector set (Mouse)
K4368201 3 x 1.0 ug
EUR 339.00
Mouse CXCL1/GROα ELISA kit (4X96T)
LF-EK50474 4×96T
EUR 2201.00
55R-1740 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory
55R-1742 1 kit
EUR 624.00
Description: ELISA kit for detection of CXCL1 in the research laboratory
CXCL1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CXCL1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL1. Recognizes CXCL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Breast cancer (BRCA) genetesting in ovarian cancer

The discovery of cancer-causing BRCA1/2 mutations and the emergence of genetic testing have brought precision in patient selection for poly-(ADP)-ribose polymerase inhibitor (PARPi) treatment. Interestingly, patients who are carriers of BRCA1/2 mutations have a higher risk for developing cancer, but respond better to DNA-damaging cytotoxic therapy, such as platinum-based chemotherapy.
The distinctive biology of ovarian cancer involves high genomic instability consisting of gene amplification, gene deletion, oncogene hypomethylation, loss of heterozygosity, and tumor suppressor gene promoter hypermethylation in many of the DNA damage response (DDR) genes, including BRCA1/2. Several of these genetic abnormalities can impair high fidelity DNA damage repair increasing the therapeutic audience for PARPi’s. This is especially important given the clinical development over the last decade of this group of agents and the dramatic increase in progression free survival among ovarian cancer patients who received PARPi, both in treatment or maintenance setting. In this review, we summarize our current understanding of the role of BRCA1/2 mutations in ovarian cancer and present relevant clinical trials in which BRCA1/2 was investigated as biomarker for therapy. We also outline the role of homologous recombination (HR) deficiency as biomarker by presenting the recent clinical development and recent approvals PARPi for firstline maintenance in ovarian cancer.

Haplotyping by linked-read sequencing (HLRS) of the genetic disease carriers for preimplantation genetictesting without a proband or relatives

Background: In order to mitigate the risk of allele dropout (ADO) and ensure the accuracy of preimplantation genetic testing for monogenic disease (PGT-M), it is necessary to construct parental haplotypes. Typically, haplotype resolution is obtained by genotyping multiple polymorphic markers in both parents and a proband or a relative. Sometimes, single sperm typing, or tests on the polar bodies may also be useful. Nevertheless, this process is time-consuming. At present, there was no simple linkage analysis strategy for patients without affected relatives.
Method: To solve this problem, we established a haplotyping by linked-read sequencing (HLRS) method without the requirement for additional relatives. First, the haplotype of the genetic disease carriers in the family was constructed by linked-read sequencing, and then the informative single nucleotide polymorphisms (SNPs) in upstream and downstream mutation region were selected to construct the embryo haplotype and to determine whether the embryo was carrying the mutation. Two families were selected to validate this method; one with alpha thalassemia and the other with NDP gene disorder.
Results: The haplotyping by linked-read sequencing (HLRS) method was successfully applied to construct parental haplotypes without recruiting additional family members; the method was also validated for PGT-M. The mutation carriers in these families were sequenced by linked-read sequencing, and their haplotypes were successfully phased. Adjacent SNPs of the mutation gene were identified.
The informative SNPs were chosen for linkage analyses to identify the carrier embryos. For the alpha thalassemia family, a normal blastocyst was transferred to the uterus and the accuracy of PGT-M was confirmed by amniocentesis at 16 weeks of gestation.
Conclusions: Our results suggest that HLRS can be applied for PGT-M of monogenic disorders or de novo mutations where the mutations haplotype cannot be determined due to absence of affected relatives.

Human Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Hu-48Tests 48 Tests
EUR 500.00

Human Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Hu-96Tests 96 Tests
EUR 692.00


DB-045-0.1 100 μl
EUR 212.00
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-0.2 200 μl
EUR 298.00
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-0.5 500 μl
EUR 384.00
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-1 1 ml
EUR 613.00
Description: rabbit monospecific clonal antibodies for ihc-p application; concentrated


DB-045-RTU-15 15 ml
EUR 354.00
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)


DB-045-RTU-7 7 ml
EUR 231.00
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)


DB045RTU-15 15 ml
EUR 354.00
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)


DB045RTU-7 7 ml
EUR 231.00
Description: rabbit monospecific clonal antibodies for ihc-p application; prediluted (ready to use)

Mouse Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Mu-48T 48T
EUR 508.00
  • Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Mu-96T 96T
EUR 661.00
  • Should the Mouse Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation (CD163) in samples from serum, plasma or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Ra-48T 48T
EUR 508.00
  • Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Cluster Of Differentiation (CD163) ELISA Kit

DLR-CD163-Ra-96T 96T
EUR 661.00
  • Should the Rat Cluster Of Differentiation (CD163) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation (CD163) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Mu-48Tests 48 Tests
EUR 534.00

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Mu-96Tests 96 Tests
EUR 742.00

Rat Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Ra-48Tests 48 Tests
EUR 534.00

Rat Cluster Of Differentiation (CD163) ELISA Kit

RDR-CD163-Ra-96Tests 96 Tests
EUR 742.00

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Mu-48Tests 48 Tests
EUR 511.00

Mouse Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Mu-96Tests 96 Tests
EUR 709.00

Rat Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Ra-48Tests 48 Tests
EUR 511.00

Rat Cluster Of Differentiation (CD163) ELISA Kit

RD-CD163-Ra-96Tests 96 Tests
EUR 709.00

Anti-CD163 Antibody

A00812-1 100ug/vial
EUR 334.00

Anti-CD163 Antibody

PA1874 100ug/vial
EUR 294.00

Anti-CD163 Antibody

PA1874-1 100ug/vial
EUR 334.00

Anti-CD163 antibody

STJ110681 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-CD163 antibody

STJ160082 1 mL C
EUR 941.00

Anti-CD163 antibody

STJ16100302 100 µg
EUR 720.00

Anti-CD163 antibody

STJ16100324 1 mL
EUR 979.00

Anti-CD163 Antibody

STJ500423 100 µg
EUR 476.00

Anti-CD163 Antibody

STJ500424 100 µg
EUR 476.00

Anti-CD163 antibody

STJ180301 0.1 ml
EUR 215.00

Anti-CD163 antibody

STJ190009 200 µl
EUR 197.00
Description: Unconjugated Mouse monoclonal to CD163 (AS1A1)

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

Anti-Hu CD163 Purified

11-645-C025 0.025 mg
EUR 99.00

Anti-Hu CD163 Purified

11-645-C100 0.1 mg
EUR 158.00

Anti-Hu CD163 APC

1A-645-T025 25 tests
EUR 140.00

Anti-Hu CD163 APC

1A-645-T100 100 tests
EUR 240.00

Anti-Hu CD163 PE

1P-645-T025 25 tests
EUR 140.00

Anti-Hu CD163 PE

1P-645-T100 100 tests
EUR 240.00

Anti-CD163/M130 Antibody

A00812 100ul
EUR 397.00
Description: Rabbit IgG polyclonal antibody for Scavenger receptor cysteine-rich type 1 protein M130 (CD163) detection.tested for IF, IHC, WB in Human, Mouse, Rat. Various direct flourescent conjugates are available for FCM upon request. Please contact us for details.

anti- CD163/M130 Antibody

FNab09771 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:300-1:1000
  • Immunogen: CD163
  • Uniprot ID: Q86VB7
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Neuroscience, Stem Cells
Description: Antibody raised against CD163/M130 

Anti-CD163/M130 antibody

PAab09771 100 ug
EUR 355.00

Anti-CD163 Antibody BIOTIN

STJ500425 100 µg
EUR 586.00

Anti-CD163 Antibody FITC

STJ500426 100 µg
EUR 586.00

Anti-CD163 Antibody BIOTIN

STJ500427 100 µg
EUR 586.00

Anti-CD163 Antibody FITC

STJ500428 100 µg
EUR 586.00

human CD163 antigen,CD163 LISA kit

201-12-0247 96 tests
EUR 440.00
  • This CD163 antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human CD163 antigen(CD163)ISA kit

GA-E0263HM-48T 48T
EUR 289.00

Human CD163 antigen(CD163)ISA kit

GA-E0263HM-96T 96T
EUR 466.00

Human CD163 antigen(CD163)ISA kit

QY-E05066 96T
EUR 361.00

Mouse Anti Human Cd163 Monoclonal Antibody

CABT-47162MH 25 µg
EUR 372.00

Mouse Anti Human Cd163 Monoclonal Antibody

CABT-47163MH 0.2 mg
EUR 881.00

Anti-CD163 Rabbit Monoclonal Antibody

M00812 100ug/vial
EUR 397.00
Description: Rabbit Monoclonal CD163 Antibody. Validated in IP, WB and tested in Human.

Anti-Hu CD163 PE-Cy7

T7-645-T025 25 tests
EUR 154.00

Anti-Hu CD163 PE-Cy7

T7-645-T100 100 tests
EUR 268.00

Anti-Hu CD163 PerCP-Cy5.5

T9-645-T025 25 tests
EUR 196.00

Anti-Hu CD163 PerCP-Cy5.5

T9-645-T100 100 tests
EUR 352.00

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

Porcine CD163 antigen,CD163 LISA kit

GA-E0045PC-48T 48T
EUR 364.00

Porcine CD163 antigen,CD163 LISA kit

GA-E0045PC-96T 96T
EUR 590.00

Canine CD163 antigen(CD163 LISA kit

GA-E0062CN-48T 48T
EUR 402.00

Canine CD163 antigen(CD163 LISA kit

GA-E0062CN-96T 96T
EUR 684.00

Mouse Anti Rat Cd163 Monoclonal Antibody

DMABT-47170MR 0.25 mg
EUR 741.00

Mouse Anti Rat Cd163 Monoclonal Antibody

DMABT-47171MR 0.1 mg
EUR 559.00

CD163 Antibody

37157-100ul 100ul
EUR 252.00

CD163 antibody

10R-CD163aRT 250 ug
EUR 716.00
Description: Mouse monoclonal CD163 antibody

CD163 antibody

10R-6496 100 ug
EUR 203.00
Description: Mouse monoclonal CD163 antibody

CD163 Antibody

49553-100ul 100ul
EUR 333.00

CD163 Antibody

49553-50ul 50ul
EUR 239.00

Cd163 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CD163 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CD163 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CD163 Antibody

DF8235 200ul
EUR 304.00
Description: CD163 Antibody detects endogenous levels of total CD163.

CD163 Antibody

  • EUR 467.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

CD163 siRNA

  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CD163 siRNA

  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CD163 Antibody

ABD8235 100 ug
EUR 438.00

Anti-Human CD163 DyLight® 488 conjugated Antibody

A00812-Dyl488 100ug/vial
EUR 344.00

Anti-Human CD163 DyLight® 550 conjugated Antibody

A00812-Dyl550 100ug/vial
EUR 344.00

Mouse Anti-Human CD163 monoclonal antibody, clone JID274

CABT-L2938-100uL500uL 100 uL, 500 uL
EUR 502.00

Human CD163 ELISA Kit

ELA-E1726h 96 Tests
EUR 824.00

Human CD163 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CD163 ELISA Kit

LF-EK50890 1×96T
EUR 648.00

Human CellExp? CD163, Human recombinant

EUR 305.00

Human CellExp? CD163, Human recombinant

EUR 773.00

Mouse Anti Rat Cd163 Monoclonal Antibody,Biotin

DMABT-47168MR 0.1 mg
EUR 881.00

Mouse Anti Rat Cd163 Monoclonal Antibody,FITC

DMABT-47169MR 0.1 mg
EUR 881.00

Mouse Anti Rat Cd163 Monoclonal Antibody,RPE

DMABT-47172MR 100 TEST
EUR 892.00

Mouse Anti Pig Cd163 Monoclonal Antibody,FITC

CABT-47164MP 0.1 mg
EUR 881.00

Mouse Anti Pig Cd163 Monoclonal Antibody,RPE

CABT-47166MP 100 TEST
EUR 715.00

Anti-CD163 Rabbit Monoclonal Antibody, Clone#RM371

M00812-1 100uL
EUR 385.00
Description: Anti-CD163 Rabbit Monoclonal Antibody, Clone#RM371 tested in WB, IHC, reactive to Human

Recombinant Porcine CD163

7-04750 10µg Ask for price

Recombinant Porcine CD163

7-04751 50µg Ask for price

Recombinant Porcine CD163

7-04752 1mg Ask for price

CD163 antibody (PE)

61R-1319 100 tests
EUR 403.00
Description: Mouse monoclonal CD163 antibody (PE)

CD163 antibody (biotin)

61R-1569 100 ug
EUR 349.00
Description: Mouse monoclonal CD163 antibody (biotin)

CD163 antibody (biotin)

61R-CD163BHUBT 100 ug
EUR 921.00
Description: Mouse monoclonal CD163 antibody (biotin)

CD163 antibody (biotin)

61R-CD163CHUBT 250 ug
EUR 781.00
Description: Mouse monoclonal CD163 antibody (biotin)

CD163 Blocking Peptide

DF8235-BP 1mg
EUR 195.00

Porcine CD163 Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

CD163 Conjugated Antibody

C49553 100ul
EUR 397.00

CD163 Conjugated Antibody

C37157 100ul
EUR 397.00

CD163 Rabbit pAb

A8383-100ul 100 ul
EUR 308.00

CD163 Rabbit pAb

A8383-200ul 200 ul
EUR 459.00

CD163 Rabbit pAb

A8383-20ul 20 ul
EUR 183.00

CD163 Rabbit pAb

A8383-50ul 50 ul
EUR 223.00

Cd163 Polyclonal Antibody

A53832 100 µg
EUR 570.55
Description: Ask the seller for details

ELISA kit for Human CD163

EK5296 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD163 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD163 PicoKine ELISA Kit

EK0715 96 wells
EUR 425.00
Description: For quantitative detection of human CD163 in cell culture supernates, serum and plasma(heparin).

QuickDetect? CD163 (Human) ELISA Kit

EUR 805.00

CD163 ORF Vector (Human) (pORF)

ORF017045 1.0 ug DNA
EUR 405.00

CD163 ELISA Kit (Human) (OKAN04666)

OKAN04666 96 Wells
EUR 792.00
Description: Description of target: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.273 ng/mL

CD163 ELISA Kit (Human) (OKBB00786)

OKBB00786 96 Wells
EUR 505.00
Description: Description of target: CD163(Cluster of Differentiation 163) is a human protein encoded by the CD163 gene. It has also been shown to mark cells of monocyte/macrophage lineage. CD163, a member of the scavenger receptor cysteine-rich(SRCR) superfamily, is exclusively expressed by monocytes and macrophages. Using FISH, somatic cell hybrid analysis, and radiation hybrid analysis, CD163 gene was mapped the to chromosome 12p13.3. CD163 is upregulated in a large range of diseases inflammatory diseases including type 2 diabetes, macrophage activation sickness, Tangier's disease, reumatoid arthritis etc.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <150pg/ml

CD163 ELISA Kit (Human) (OKBB01513)

OKBB01513 96 Wells
EUR 570.00
Description: Description of target: CD163(Cluster of Differentiation 163) is a human protein encoded by the CD163 gene. It has also been shown to mark cells of monocyte/macrophage lineage. CD163, a member of the scavenger receptor cysteine-rich(SRCR) superfamily, is exclusively expressed by monocytes and macrophages. Using FISH, somatic cell hybrid analysis, and radiation hybrid analysis, CD163 gene was mapped the to chromosome 12p13.3. CD163 is upregulated in a large range of diseases inflammatory diseases including type 2 diabetes, macrophage activation sickness, Tangier's disease, reumatoid arthritis etc.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <150pg/ml

CD163 ELISA Kit (Human) (OKCD07621)

OKCD07621 96 Wells
EUR 936.00
Description: Description of target: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.273ng/mL

Human soluble CD163(sCD163) ELISA Kit

CSB-E14050h-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human soluble CD163 (sCD163) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human soluble CD163(sCD163) ELISA Kit

  • EUR 794.00
  • EUR 5028.00
  • EUR 2667.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human soluble CD163(sCD163) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

CD163 sgRNA CRISPR Lentivector set (Human)

K0405601 3 x 1.0 ug
EUR 339.00

Cd163 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Cd163 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Cd163 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Cd163. Recognizes Cd163 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

CD163 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD163 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD163 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD163. Recognizes CD163 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Canine CD163 ELISA Kit

ELI-05600d 96 Tests
EUR 928.00

CD163(M130/1240) Antibody

BNUM1240-50 50uL
EUR 395.00
Description: Primary antibody against CD163(M130/1240), 1mg/mL

CD163(M130/1240) Antibody

BNUB1240-100 100uL
EUR 209.00
Description: Primary antibody against CD163(M130/1240), Concentration: 0.2mg/mL

CD163(M130/1240) Antibody

BNUB1240-500 500uL
EUR 458.00
Description: Primary antibody against CD163(M130/1240), Concentration: 0.2mg/mL

CD163(M130/1240) Antibody

BNC551240-100 100uL
EUR 199.00
Description: Primary antibody against CD163(M130/1240), CF555 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC551240-500 500uL
EUR 544.00
Description: Primary antibody against CD163(M130/1240), CF555 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC611240-100 100uL
EUR 199.00
Description: Primary antibody against CD163(M130/1240), CF660R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC611240-500 500uL
EUR 544.00
Description: Primary antibody against CD163(M130/1240), CF660R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC471240-100 100uL
EUR 199.00
Description: Primary antibody against CD163(M130/1240), CF647 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC471240-500 500uL
EUR 544.00
Description: Primary antibody against CD163(M130/1240), CF647 conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC051240-100 100uL
EUR 199.00
Description: Primary antibody against CD163(M130/1240), CF405M conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC051240-500 500uL
EUR 544.00
Description: Primary antibody against CD163(M130/1240), CF405M conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC401240-100 100uL
EUR 199.00
Description: Primary antibody against CD163(M130/1240), CF640R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC401240-500 500uL
EUR 544.00
Description: Primary antibody against CD163(M130/1240), CF640R conjugate, Concentration: 0.1mg/mL

CD163(M130/1240) Antibody

BNC431240-100 100uL
EUR 199.00
Description: Primary antibody against CD163(M130/1240), CF543 conjugate, Concentration: 0.1mg/mL

Leave a Reply

Your email address will not be published. Required fields are marked *